Everything below concerns Preclinical research. We keep the language plain, cite what the science says, and separate well-supported claims from open questions.
Last reviewed on 2025-08-16. Where a claim depends on a specific study, the study is described rather than over-claimed.
Dihexa is a synthetic compound studied in laboratory and animal models for effects on synaptic connectivity and cognitive performance. It is often described as a peptide analog because its structure incorporates amino acid residues linked to a hexanoic acid group. The molecule is not a naturally occurring human hormone or neurotransmitter. Its name appears in research literature and online discussions, but it has not been approved as a medicine by major regulatory agencies. Most information comes from preclinical experiments rather than controlled human trials.
The compound originated from work on angiotensin IV, a peptide fragment of the renin-angiotensin system. Researchers modified angiotensin IV-related structures to produce molecules with altered stability and activity. Dihexa emerged from that effort and was reported to promote dendritic spine growth in cultured neurons. Some studies link its effects to hepatocyte growth factor signaling and the c-Met receptor, while other work points to insulin-regulated aminopeptidase. The precise primary target remains a subject of investigation, and findings may depend on cell type, assay conditions, and species.
Dissolution depends on the peptide’s salt form, purity, and the chosen solvent. Dimethyl sulfoxide is commonly used to prepare concentrated stock solutions, while aqueous buffers may show limited solubility. Sonication or gentle warming can sometimes aid dissolution, but excessive heat may promote degradation. Once in solution, the material is generally kept cold and protected from light. Researchers should verify solubility for each lot rather than assuming uniform behavior across suppliers.
Quality control usually combines reverse-phase high-performance liquid chromatography with mass spectrometry. Chromatography estimates purity and detects related impurities, while mass spectrometry supports molecular identity. Nuclear magnetic resonance can provide additional structural confirmation when needed. Stability data for dihexa are limited, and degradation pathways may depend on pH, temperature, and moisture. Open questions include long-term stability in different formulations and the effect of repeated freeze-thaw cycles on measured purity. Such tests help confirm that a batch matches its label before use.
In laboratory settings, dihexa is typically handled as a lyophilized peptide powder. Appropriate personal protective equipment and a ventilated workspace are standard practices for weighing and transferring research chemicals. Because the compound lacks regulatory approval for clinical use, it should not be given to people. Institutional safety rules and local regulations govern its acquisition, storage, and disposal. Suppliers often provide a certificate of analysis that lists purity, identity, and batch-specific handling notes.
| Property | Value | Notes |
|---|---|---|
| Chemical class | Synthetic peptide analog | Structural features include amino acid residues and a hexanoic acid group. |
| Common synonyms | PNB-0408; N-hexanoic-Tyr-Ile-(6)-aminohexanoic amide | Names vary by source and should be verified. |
| Origin | Angiotensin IV research | Developed as a modified analog in academic laboratories. |
| Primary research focus | Synaptic growth and cognition | Studied mainly in cultured neurons and rodent models. |
| Regulatory status | Not approved as a drug | No accepted human therapeutic or supplement status. |
The proposed mechanism for dihexa centers on hepatocyte growth factor, or HGF, and its receptor c-Met. HGF signaling is involved in cell growth, survival, and synapse formation. Dihexa has been described as an HGF mimetic or modulator in preclinical literature. Whether it binds c-Met directly, increases HGF availability, or acts through another route remains uncertain. This mechanistic uncertainty is a recurring theme in reviews of the compound, and no single molecular model has been confirmed across independent laboratories.
Research on dihexa has primarily used rodent models and cultured cells. Common endpoints include dendritic spine density, synaptic protein expression, and performance on maze or avoidance tasks. Some studies report improvements in cognitive measures after scopolamine-induced deficits or in aged animals. These findings are interesting but come from a small body of work, and independent laboratories have not consistently replicated all reported effects. Larger, preregistered studies would help clarify which results are robust.
Human data for dihexa remain absent from peer-reviewed clinical literature. As a result, questions about absorption, distribution, metabolism, excretion, and long-term safety are unresolved. Discussions often appear in nootropic forums, where anecdotal reports cannot substitute for controlled trials. Researchers have called for more rigorous pharmacokinetic and toxicological studies before any clinical evaluation. Until such data exist, dihexa is best described as an investigational research compound rather than a proven intervention.
Chemically, dihexa is a short peptide-like molecule with nonstandard components. Its structure includes tyrosine and isoleucine residues linked to a hexanoic acid group and an aminohexanoic amide segment. This design distinguishes it from endogenous angiotensin IV, though the two are discussed together because of shared origins. Published summaries classify it as a small synthetic peptide with lipophilic features that may influence how it crosses biological barriers in experimental systems. Exact conformational details depend on the specific salt or free base form.
Regulatory treatment varies by country. Dihexa does not appear in major pharmacopeias as a licensed therapeutic substance. Suppliers may use labels such as research use only or not for human consumption. Such labels reflect legal and quality-control boundaries rather than evidence of clinical benefit. Importation, possession, and sale can be restricted depending on local laws, and enforcement focuses on claims, distribution channels, and product categories. These rules can change, and they differ from rules for approved medicines.
Dihexa is a synthetic peptide studied in preclinical neuroscience. It is often described as an angiotensin IV analog or derivative. The compound also appears under research codes such as PNB-0408 and N-hexanoic-Tyr-Ile-(6)-aminohexanoic amide. It is not an approved drug, and it is not a conventional vitamin or nutrient. In many jurisdictions, material sold as dihexa is handled as a research chemical rather than a medicine or supplement. This classification affects how the material is labeled and distributed.
Most published work on dihexa consists of preclinical studies using cell cultures or rodents. Reports have described effects on synaptic connectivity and performance on cognitive tasks in some animal models. These findings are generally presented as preliminary and require independent replication. Study designs, doses, and outcome measures vary across experiments, which complicates direct comparison. No large controlled human trials have established efficacy or safety for any medical use. At present, the evidence base is limited.
Regulatory agencies have not approved dihexa as a prescription drug or supplement. In many countries it falls into a gray area when sold for laboratory research. Buyers may encounter products marketed for research use only, which are not intended for human consumption. Purity and identity can vary between suppliers and batches. Certificates of analysis and independent testing are often recommended for research materials. Documentation helps verify what a vial contains.
Discussion of dihexa in online communities sometimes outpaces the scientific record. Anecdotal reports are difficult to verify and may not distinguish effects from placebo or expectation. The absence of approved human data means long-term risks remain unknown. Researchers continue to investigate related compounds and pathways. Open questions include whether animal findings translate to humans and which biological targets matter most. No consensus exists on these points. Current reviews emphasize the need for rigorous clinical research.
Regulatory status differs by country, but dihexa is generally not approved as a therapeutic product. It is often sold as a research chemical, which means purity, labeling, and handling fall outside pharmaceutical drug standards. Some jurisdictions restrict the sale of peptides intended for human consumption. Researchers and suppliers may therefore face different legal requirements depending on location. Import rules and customs enforcement can also affect how such compounds move across borders.
Human safety data are sparse. No widely accepted dosing regimen, long-term safety profile, or clinical efficacy endpoint has been established. Published animal results can suggest directions for further study, but species differences and study design limit direct translation. Open questions include bioavailability, blood-brain barrier penetration, metabolism, and whether observed effects arise from a single target or multiple pathways. Replication across independent laboratories remains an important benchmark for evaluating the strength of preclinical claims.
Most published reports on dihexa come from cell cultures and animal models. Studies have examined markers of synapse formation, dendritic spine density, and performance on learning tasks in rodents. Proposed mechanisms center on hepatocyte growth factor and its c-Met receptor, with additional attention to angiotensin IV-related pathways. These findings are experimental and have not been confirmed as clinical benefits in humans. The literature often uses different tasks and endpoints, which complicates direct comparison across studies.
==== Temperature ==== As the temperature in the environment increases, molecules move faster. Hydrogen bonds and hydrophobic interactions are important stabilizing forces in proteins. If the temperature rises and molecules containing these interactions are moving too fast, the interactions become compromised or even break. At high temperatures, these interactions cannot form, and a functional protein is denatured. However, it relies on two factors; the type of protein used and the amount of heat applied. The amount of heat applied determines whether this change in protein is permanent or if it can be transformed back to its original form.
=== Other elements === Not all elements which are found in the human body in trace quantities play a role in life. Some of these elements are thought to be simple common contaminants without function (examples: caesium, titanium), while many others are thought to be active toxins, depending on amount (cadmium, mercury, lead, radioactives). In humans, arsenic is toxic, and its levels in foods and dietary supplements are closely monitored to reduce or eliminate its intake. Some elements (silicon, boron, nickel, vanadium) are probably needed by mammals also, but in far smaller doses. Bromine is used by some (though not all) bacteria, fungi, diatoms, and seaweeds, and opportunistically in eosinophils in humans. One study has indicated bromine to be necessary to collagen IV synthesis in humans. Fluorine is used by a number of plants to manufacture toxins but in humans its only known function is as a local topical hardening agent in tooth enamel.
In contrast, the darker arc-like areas in a stained section of dentin are considered interglobular dentin. In these areas, only primary mineralization has occurred within the predentin, and the globules of dentin do not fuse completely. Thus, interglobular dentin is slightly less mineralized than globular dentin. Interglobular dentin is especially evident in coronal dentin, near the dentinoenamel junction (DEJ), and in certain dental anomalies, such as in dentinogenesis imperfecta.
=== Singles/EPs/demos === "Children Break" (1988) Barging Into the Presence of God EP (September 1989) UK Indie No. 3 UK No. 135 Half-Life EP (October 1990), 12" contains a bonus spoken-word track "Colour of the Sky" UK No. 86 "Kinky Love" (1991) (12" issued as Flesh Balloon EP) (June 1991) UK No. 72 "Porpoise" (1991) "Throwing Back the Apple" (May 1992) UK No. 93 Fine Friend EP (August 1994) "Fine Friend" (1994), US promo including "One Blue Hill" live acoustic @ KCRW "Angel (Will You Be My)" (1995), US promo
Sources: en.wikipedia.org
(2026) determine the age of the carbon black-based figures in the rock art from the Font-de-Gaume cave (France) on the basis of chemical imaging and radiocarbon dating. Parfitt et al. (2026) identify an Upper Paleolithic pendant made out of a polished seal tooth from the Kents Cavern (United Kingdom), which was an inland site during the Magdalenian occupation. Allaby et al. (2026) reconstruct the environment of the Southern River system in southern Doggerland on the basis of sedimentological and sedimentary ancient DNA, and report evidence indicating that early colonization of Doggerland was facilitated by presence of northern refugia during the early Mesolithic. Evidence indicating that early Paleo-Indians from eastern Beringia, North American Clovis complex and South American Fishtail Projectile Point complex were dietary specialists feeding on Pleistocene megafauna is presented by Potter et al. (2026). Eren et al. (2026) argue that Pleistocene sites in North America with proboscidean remains associated with Clovis points representing hunting and scavenging events cannot be reliably distinguished on the basis of available evidence, and argue that Clovis foragers likely practiced both hunting and scavenging of large Pleistocene mammals. Evidence from the study of assemblages of Pleistocene perishable objects from the Cougar Mountain Cave and Paisley Caves (Oregon, United States), indicative of complexity and sophistication of perishable technologies in the North American Great Basin during the Late Pleistocene, is presented by Rosencrance et al. (2026).
==== Transformation of kerogen into fossil fuels ==== Kerogen formation continued to a depth of about 1 km from the Earth's surface where temperatures may reach around 50 °C. Kerogen formation represents a halfway point between organic matter and fossil fuels: kerogen can be exposed to oxygen, oxidize and thus be lost, or it could be buried deeper inside the Earth's crust and be subjected to conditions which allow it to slowly transform into fossil fuels like petroleum. The latter happened through catagenesis in which the reactions were mostly radical rearrangements of kerogen. These reactions took thousands to millions of years, and no external reactants were involved. Due to the radical nature of these reactions, kerogen reacted towards two classes of products: those with low H/C ratio (anthracene or products similar to it) and those with high H/C ratio (methane or products similar to it); i.e., carbon-rich or hydrogen-rich products. Because catagenesis was closed off from external reactants, the resulting composition of the fuel mixture was dependent on the composition of the kerogen via reaction stoichiometry. Three types of kerogen exist: type I (algal), II (liptinic) and III (humic), which were formed mainly from algae, plankton and woody plants (this term includes trees, shrubs and lianas) respectively.
=== Polyadenylation === Based on software analysis of the mRNA sequences various polyadenylation patterns could be identified for the transcription variants . TV1 and TV2 share the same pattern located on exon 10 starting at position 1246 resulting in a 32 nucleotide motif (AGUAGAGUCUGCGCUGUGACCUUCUGUUGGGC). TV3 uses a motif on exon 11 at the position 320. The motif is also 32 nucleotides long, but differs from the sequence used by TV1/2 (AGUGGCUUGUUCCACCUCAGCUCCCAUCUAAC). The difference in the polyadenylation sequence results in a variance of the minimum free energy values of the predicted RNA folding structures (-28.70 kcal/mol, TV1 and TV2 and -16.03 kcal/mol, TV3), which could result in different length of the Poly-A tail. Based on the observation that stable secondary structures result in decreased polyadenylation of the specific site, this might indicate that TV1 and TV2 are less polyadenylated in comparison to TV3.
Sources: en.wikipedia.org
Dihexa is a synthetic peptide-like compound studied primarily in preclinical models. It is often classified as an angiotensin IV analog and has been investigated for effects on neuronal connectivity. It is not an approved drug or dietary supplement.
The exact mechanism is uncertain. Some research proposes activation of hepatocyte growth factor/c-Met signaling, while other evidence implicates insulin-regulated aminopeptidase. Multiple pathways may contribute, depending on the experimental system.
Published large-scale human trials are lacking. Most available data come from cell cultures and animal studies. As a result, human safety, appropriate dosing, and clinical effectiveness are not established.
Typical storage is at -20 °C in a desiccated container protected from light. Repeated freeze-thaw cycles are usually minimized to reduce degradation. Specific conditions should follow the supplier’s documentation.